Read the given passage and answer the following question.\ A transcription unit in DNA is defined p

Question

Read the given passage and answer the following question.\ A transcription unit in DNA is defined primarily by the three regions in the DNA: (i) A promoter (ii) The structural gene (iii) A terminator. A sequence of DNA from a transcription unit is given.\ $3^{\prime}$ - ATGCATGCATGCATGCATGCATGC - $5^{\prime}$ - A\ 5' - TACGTACGTACGTACGTACGTACG - 3' - B \ What would be the sequence of RNA transcribed from the above DNA?\

Professor PC Thomas Classes · Answer

(b) : Coding strand of DNA has the same sequence of nitrogenous bases as the RNA transcript except that in RNA T (thymine) is substituted by U (uracil). It has the same polarity as the RNA transcript.